Learn Python Tutorials

I'm using the MRJob module for python 2.7. I have created a class that inherits from MRJob, and… Read more Mrjob And Python - .csv File Output For Reducer?

I have this very simple Python function, but there is one part I am confused about. The function is… Read more Why Does This Python Function Only Have One Output?

I am able to get the output/predictions of all layers as suggested in Keras Docs: how-can-i-obtain-… Read more Keras/tensorflow: Get Predictions Or Output Of All Layers Efficiently

So what I want to do is save the output of this program into a text file. import itertools res = i… Read more How Do I Save Output Into A Text File In Python?

I have the following list of dictionaries: [{'Sequence': 'TGACCCTGCTTGGCGATCCCGGCGTTTC&… Read more Python: List Of Dictionaries: How To - Nice Printout Using Sys.stdout

I am struggeling in writing the output of my code to a txt file while keeping the format. Here is t… Read more Python - Write Matrix To Txt File, Keep Formatting

I have a python script and it takes a long time to finish. I would like to run it from Java, but al… Read more Java: Is There A Way To Run A System Command And Print The Output During Execution?

In Find all possible combinations that overlap by end and start, we get the following program that … Read more Modify For List Output In Recursion

I am using python 3. My code uses pdfminer to convert pdf to text. I want to get the output of thes… Read more Redirect Output Of A Function That Converts Pdf To Txt Files To A New Folder In Python