Skip to content Skip to sidebar Skip to footer
Showing posts with the label Output
Mrjob And Python - .csv File Output For Reducer?

Mrjob And Python - .csv File Output For Reducer?

Post a Comment
I'm using the MRJob module for python 2.7. I have created a class that inherits from MRJob, and… Read more Mrjob And Python - .csv File Output For Reducer?
Why Does This Python Function Only Have One Output?

Why Does This Python Function Only Have One Output?

Post a Comment
I have this very simple Python function, but there is one part I am confused about. The function is… Read more Why Does This Python Function Only Have One Output?
Keras/tensorflow: Get Predictions Or Output Of All Layers Efficiently

Keras/tensorflow: Get Predictions Or Output Of All Layers Efficiently

Post a Comment
I am able to get the output/predictions of all layers as suggested in Keras Docs: how-can-i-obtain-… Read more Keras/tensorflow: Get Predictions Or Output Of All Layers Efficiently
How Do I Save Output Into A Text File In Python?

How Do I Save Output Into A Text File In Python?

Post a Comment
So what I want to do is save the output of this program into a text file. import itertools res = i… Read more How Do I Save Output Into A Text File In Python?
Python: List Of Dictionaries: How To - Nice Printout Using Sys.stdout

Python: List Of Dictionaries: How To - Nice Printout Using Sys.stdout

Post a Comment
I have the following list of dictionaries: [{'Sequence': 'TGACCCTGCTTGGCGATCCCGGCGTTTC&… Read more Python: List Of Dictionaries: How To - Nice Printout Using Sys.stdout
Python - Write Matrix To Txt File, Keep Formatting

Python - Write Matrix To Txt File, Keep Formatting

Post a Comment
I am struggeling in writing the output of my code to a txt file while keeping the format. Here is t… Read more Python - Write Matrix To Txt File, Keep Formatting