Skip to content Skip to sidebar Skip to footer
Showing posts with the label Output

Mrjob And Python - .csv File Output For Reducer?

I'm using the MRJob module for python 2.7. I have created a class that inherits from MRJob, and… Read more Mrjob And Python - .csv File Output For Reducer?

Why Does This Python Function Only Have One Output?

I have this very simple Python function, but there is one part I am confused about. The function is… Read more Why Does This Python Function Only Have One Output?

Keras/tensorflow: Get Predictions Or Output Of All Layers Efficiently

I am able to get the output/predictions of all layers as suggested in Keras Docs: how-can-i-obtain-… Read more Keras/tensorflow: Get Predictions Or Output Of All Layers Efficiently

How Do I Save Output Into A Text File In Python?

So what I want to do is save the output of this program into a text file. import itertools res = i… Read more How Do I Save Output Into A Text File In Python?

Python: List Of Dictionaries: How To - Nice Printout Using Sys.stdout

I have the following list of dictionaries: [{'Sequence': 'TGACCCTGCTTGGCGATCCCGGCGTTTC&… Read more Python: List Of Dictionaries: How To - Nice Printout Using Sys.stdout

Python - Write Matrix To Txt File, Keep Formatting

I am struggeling in writing the output of my code to a txt file while keeping the format. Here is t… Read more Python - Write Matrix To Txt File, Keep Formatting

Java: Is There A Way To Run A System Command And Print The Output During Execution?

I have a python script and it takes a long time to finish. I would like to run it from Java, but al… Read more Java: Is There A Way To Run A System Command And Print The Output During Execution?

Modify For List Output In Recursion

In Find all possible combinations that overlap by end and start, we get the following program that … Read more Modify For List Output In Recursion